ID: 999322028_999322042

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 999322028 999322042
Species Human (GRCh38) Human (GRCh38)
Location 5:150621447-150621469 5:150621496-150621518
Sequence CCTTTCTGCTCCCTTGGGAAAGG CTGGAGATCAGGAGGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 254} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!