ID: 999330209_999330218

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 999330209 999330218
Species Human (GRCh38) Human (GRCh38)
Location 5:150668673-150668695 5:150668708-150668730
Sequence CCTGCCAAGGTCCTCACCATTCT CTGCAAAAGGCTTCCTTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 29, 4: 289} {0: 1, 1: 1, 2: 0, 3: 21, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!