ID: 999364023_999364034

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 999364023 999364034
Species Human (GRCh38) Human (GRCh38)
Location 5:151009676-151009698 5:151009726-151009748
Sequence CCTATCCTGGGGACCAGGTTAGG TCTCTAAAATGCTCTGCAAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!