ID: 999367630_999367638

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 999367630 999367638
Species Human (GRCh38) Human (GRCh38)
Location 5:151033442-151033464 5:151033469-151033491
Sequence CCTGGGTAGCAGCCCAGAGCCAG TGGACACCCACCTGCCACCACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 143, 4: 627} {0: 1, 1: 0, 2: 0, 3: 18, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!