|
Left Crispr |
Right Crispr |
| Crispr ID |
999369464 |
999369473 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:151045202-151045224
|
5:151045253-151045275
|
| Sequence |
CCTGCCTCAGTCTGAGTGGGTGG |
TAATTTTTTGTATTTTTAGTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 13, 3: 95, 4: 400} |
{0: 623, 1: 530, 2: 860, 3: 3276, 4: 6000} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|