ID: 999369877_999369885

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 999369877 999369885
Species Human (GRCh38) Human (GRCh38)
Location 5:151048205-151048227 5:151048239-151048261
Sequence CCAGGCTCTAGGGTGGTGCACCC GAGGGAGAGAGGAGTCCACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114} {0: 1, 1: 0, 2: 1, 3: 38, 4: 397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!