ID: 999373060_999373066

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 999373060 999373066
Species Human (GRCh38) Human (GRCh38)
Location 5:151067972-151067994 5:151067999-151068021
Sequence CCTCCAAAACACGCAACACTCAG TCTTGGCGCTGGGGAGTCAACGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 17, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!