ID: 999397360_999397367

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 999397360 999397367
Species Human (GRCh38) Human (GRCh38)
Location 5:151238550-151238572 5:151238579-151238601
Sequence CCCAGCAGCTAAAAATAAAACTT CCCCTCCTGCCCTTGGGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 487} {0: 1, 1: 0, 2: 6, 3: 69, 4: 571}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!