ID: 999418431_999418438

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 999418431 999418438
Species Human (GRCh38) Human (GRCh38)
Location 5:151419895-151419917 5:151419908-151419930
Sequence CCCCCAGTGGGCGTGGTCAGGGA TGGTCAGGGAGCCAGGCATGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 34, 4: 392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!