ID: 999428828_999428833

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 999428828 999428833
Species Human (GRCh38) Human (GRCh38)
Location 5:151508981-151509003 5:151509020-151509042
Sequence CCAAGTTTGGGAGCCCTAAAACC CTCTTTCTCTCTAGGATTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 97} {0: 1, 1: 0, 2: 1, 3: 42, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!