ID: 999431955_999431965

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 999431955 999431965
Species Human (GRCh38) Human (GRCh38)
Location 5:151532013-151532035 5:151532038-151532060
Sequence CCTCTGGACCTGCCTGCAGCAAA CTGCAGCCACAGGAGGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 247} {0: 1, 1: 0, 2: 7, 3: 64, 4: 598}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!