ID: 999436380_999436384

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 999436380 999436384
Species Human (GRCh38) Human (GRCh38)
Location 5:151566689-151566711 5:151566705-151566727
Sequence CCATTAAAACCAGCATCAGGGTC CAGGGTCAGTGGCTGCTAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 123} {0: 1, 1: 0, 2: 1, 3: 18, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!