ID: 999462697_999462702

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 999462697 999462702
Species Human (GRCh38) Human (GRCh38)
Location 5:151771067-151771089 5:151771086-151771108
Sequence CCCGCGGCCGCCTCGCAGCGCCC GCCCGCCAAGAAGCGCCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 330} {0: 1, 1: 0, 2: 1, 3: 4, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!