|
Left Crispr |
Right Crispr |
| Crispr ID |
999468807 |
999468814 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:151832627-151832649
|
5:151832675-151832697
|
| Sequence |
CCTCCAAGAAATACAGGACTCTG |
TGGTGTACCTGAAAGTGACGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 32, 2: 357, 3: 6544, 4: 2860} |
{0: 1903, 1: 5071, 2: 2096, 3: 983, 4: 706} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|