ID: 999498029_999498038

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 999498029 999498038
Species Human (GRCh38) Human (GRCh38)
Location 5:152119400-152119422 5:152119442-152119464
Sequence CCACTGCATTCCAGAGGTGCAGA CTGTGTCAGGAGCAGGTGGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!