ID: 999501364_999501368

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 999501364 999501368
Species Human (GRCh38) Human (GRCh38)
Location 5:152149780-152149802 5:152149811-152149833
Sequence CCTCAGTAGAAGGTTATCCCTCA CCTTTGTAAGCCCTGCCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 100} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!