ID: 999592046_999592052

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 999592046 999592052
Species Human (GRCh38) Human (GRCh38)
Location 5:153158838-153158860 5:153158862-153158884
Sequence CCCGCCTGCTTTTCCTTTTCCTG CTCACTGTTTCTGTCCTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 138, 4: 1103} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!