ID: 999622877_999622895

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 999622877 999622895
Species Human (GRCh38) Human (GRCh38)
Location 5:153490410-153490432 5:153490459-153490481
Sequence CCCACCTCCACCTTTCTGCACAC GGAGGAAGGGGGAACAGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 397} {0: 1, 1: 0, 2: 10, 3: 105, 4: 993}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!