ID: 999623912_999623917

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 999623912 999623917
Species Human (GRCh38) Human (GRCh38)
Location 5:153500159-153500181 5:153500201-153500223
Sequence CCCTGACTAGTTTGAAGATCCTG TGCTCTCCTCTCAGCCACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 142} {0: 1, 1: 0, 2: 0, 3: 26, 4: 484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!