ID: 999640128_999640133

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 999640128 999640133
Species Human (GRCh38) Human (GRCh38)
Location 5:153664125-153664147 5:153664144-153664166
Sequence CCCTCTTTTTAAGACAGAAAAAT AAATAGAGAATACAATGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 183, 4: 1120} {0: 1, 1: 0, 2: 1, 3: 66, 4: 551}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!