ID: 999652413_999652417

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 999652413 999652417
Species Human (GRCh38) Human (GRCh38)
Location 5:153780348-153780370 5:153780393-153780415
Sequence CCATGTGATCTTGAGAAAGTAGC TCAAGACTGGTATGAATCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 378} {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!