ID: 999654014_999654028

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 999654014 999654028
Species Human (GRCh38) Human (GRCh38)
Location 5:153795134-153795156 5:153795184-153795206
Sequence CCAAGGCTGGGTGAGCAGCCAGA GCACCCATGGCAGCTGGACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 293} {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!