ID: 999654520_999654530

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 999654520 999654530
Species Human (GRCh38) Human (GRCh38)
Location 5:153799086-153799108 5:153799132-153799154
Sequence CCCCTGACAAGCTGCCTAGCTTT TAGGAGAATGGGGTACCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 208} {0: 1, 1: 0, 2: 0, 3: 14, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!