ID: 999676381_999676384

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 999676381 999676384
Species Human (GRCh38) Human (GRCh38)
Location 5:154007370-154007392 5:154007408-154007430
Sequence CCAGGCCACACCACATGTGAGTA GAATCACAGAATCATATTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!