ID: 999676381_999676384 |
View in Genome Browser |
Spacer: 15 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 999676381 | 999676384 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 5:154007370-154007392 | 5:154007408-154007430 |
Sequence | CCAGGCCACACCACATGTGAGTA | GAATCACAGAATCATATTCCCGG |
Strand | - | + |
Off-target summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 110} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |