|
Left Crispr |
Right Crispr |
| Crispr ID |
999676767 |
999676769 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:154011989-154012011
|
5:154012029-154012051
|
| Sequence |
CCACTGAATGGTTTTAAGCAGAA |
TTTTAGAAAGATCACTTTGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 25, 3: 200, 4: 771} |
{0: 1, 1: 6, 2: 41, 3: 141, 4: 713} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|