|
Left Crispr |
Right Crispr |
| Crispr ID |
999689946 |
999689951 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:154138205-154138227
|
5:154138219-154138241
|
| Sequence |
CCTATAGACCTAGCTACCTGGGA |
TACCTGGGAGGCCGAGGCGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 20, 2: 883, 3: 10388, 4: 73619} |
{0: 1, 1: 4, 2: 202, 3: 3004, 4: 11887} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|