ID: 999694319_999694320

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 999694319 999694320
Species Human (GRCh38) Human (GRCh38)
Location 5:154175291-154175313 5:154175309-154175331
Sequence CCACTGAGTGTATGTGTGTATAT TATATGAACATGCATTCAGTAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 26, 3: 235, 4: 1934} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!