ID: 999697859_999697867

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 999697859 999697867
Species Human (GRCh38) Human (GRCh38)
Location 5:154202307-154202329 5:154202339-154202361
Sequence CCTGGTGTGGCAGTGGGGCATGG CACAGCTCGGTGTGGTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 351} {0: 1, 1: 0, 2: 1, 3: 22, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!