ID: 999730827_999730836

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 999730827 999730836
Species Human (GRCh38) Human (GRCh38)
Location 5:154475827-154475849 5:154475863-154475885
Sequence CCAGACTTGCTGCGGCCAGCCGG CCTCTTCTCGACTGGGCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 138} {0: 1, 1: 0, 2: 1, 3: 9, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!