ID: 999730830_999730837

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 999730830 999730837
Species Human (GRCh38) Human (GRCh38)
Location 5:154475846-154475868 5:154475867-154475889
Sequence CCGGTGCGTCCTTTAATCCTCTT TTCTCGACTGGGCCCAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 192} {0: 1, 1: 0, 2: 0, 3: 13, 4: 143}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
-2 5:154475846-154475868 CCGGTGCGTCCTTTAATCCTCTT - 5:154475867-154475889 TTCTCGACTGGGCCCAGGGCAGG +