ID: 999763587_999763592

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 999763587 999763592
Species Human (GRCh38) Human (GRCh38)
Location 5:154721583-154721605 5:154721606-154721628
Sequence CCTGCCAGCCACTGCAGGGAAGC ACCTTGTGTGGCTGAGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 295} {0: 1, 1: 0, 2: 0, 3: 20, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!