ID: 999768104_999768106

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 999768104 999768106
Species Human (GRCh38) Human (GRCh38)
Location 5:154755810-154755832 5:154755829-154755851
Sequence CCGAAGAGCACGGGGGGCTGGTG GGTGAGGAAGAAGCCGCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 145} {0: 1, 1: 0, 2: 1, 3: 15, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!