ID: 999776733_999776742

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 999776733 999776742
Species Human (GRCh38) Human (GRCh38)
Location 5:154817970-154817992 5:154817991-154818013
Sequence CCACAACCCCTCTATGAACAGAC ACTTTTCCACAGGGGGGTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!