ID: 999892382_999892386

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 999892382 999892386
Species Human (GRCh38) Human (GRCh38)
Location 5:155993151-155993173 5:155993169-155993191
Sequence CCATTTTCCCTTCAGTCCTTCTG TTCTGCCTCTTGCCCCGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 760} {0: 1, 1: 0, 2: 1, 3: 11, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!