|
Left Crispr |
Right Crispr |
| Crispr ID |
999893187 |
999893192 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:156000892-156000914
|
5:156000917-156000939
|
| Sequence |
CCAGGTGTTGCTGATGCTGCTGA |
CAGGGACCACACTTTGAGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 41, 2: 310, 3: 938, 4: 2133} |
{0: 1, 1: 3, 2: 3, 3: 43, 4: 202} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|