ID: 999918976_999918978

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 999918976 999918978
Species Human (GRCh38) Human (GRCh38)
Location 5:156297157-156297179 5:156297207-156297229
Sequence CCACTGATACTCTCTTAGTTATT AACCATTGTGGAAGTCAGTGTGG
Strand - +
Off-target summary No data {0: 10693, 1: 12096, 2: 7438, 3: 4425, 4: 4285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!