ID: 999932745_999932749

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 999932745 999932749
Species Human (GRCh38) Human (GRCh38)
Location 5:156451313-156451335 5:156451335-156451357
Sequence CCCAAAGGACCTTGATTAATGCA ATAGATTTCAACAAGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 141} {0: 1, 1: 0, 2: 0, 3: 13, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!