ID: 999935323_999935327

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 999935323 999935327
Species Human (GRCh38) Human (GRCh38)
Location 5:156479949-156479971 5:156479965-156479987
Sequence CCAACAGCTGCTGTCTTGCCCTG TGCCCTGGGAGGAGCCCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 328} {0: 1, 1: 0, 2: 3, 3: 55, 4: 473}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!