ID: 999960239_999960243

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 999960239 999960243
Species Human (GRCh38) Human (GRCh38)
Location 5:156747338-156747360 5:156747388-156747410
Sequence CCTTTCATTTTCTGTAGGTCAGG TGATTCAAGACTTTTTTATGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 28, 4: 237} {0: 1, 1: 0, 2: 1, 3: 27, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!