ID: 999998796_999998799

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 999998796 999998799
Species Human (GRCh38) Human (GRCh38)
Location 5:157118094-157118116 5:157118128-157118150
Sequence CCATTCTGCACATTCTCATAGAT CACAAATAGAGAAGCTTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 229} {0: 1, 1: 0, 2: 2, 3: 15, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!