ID: 551982233

View in Genome Browser
Species Mouse (GRCm38)
Location 9:119542997-119543019
Sequence GGCATATCGAAAGGGCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
551982227_551982233 7 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 551982227 9:119542967-119542989 CCCGGCTCTGGCAAAGGTATTCT 0: 1
1: 0
2: 1
3: 6
4: 155
Right 551982233 9:119542997-119543019 GGCATATCGAAAGGGCCTTCTGG 0: 1
1: 0
2: 0
3: 0
4: 32
551982222_551982233 30 Left 551982222 9:119542944-119542966 CCAGGGAGATTCTTTCACTGCCT No data
Right 551982233 9:119542997-119543019 GGCATATCGAAAGGGCCTTCTGG 0: 1
1: 0
2: 0
3: 0
4: 32
551982228_551982233 6 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 551982228 9:119542968-119542990 CCGGCTCTGGCAAAGGTATTCTG 0: 1
1: 0
2: 1
3: 8
4: 127
Right 551982233 9:119542997-119543019 GGCATATCGAAAGGGCCTTCTGG 0: 1
1: 0
2: 0
3: 0
4: 32
551982226_551982233 10 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 551982226 9:119542964-119542986 CCTCCCGGCTCTGGCAAAGGTAT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 551982233 9:119542997-119543019 GGCATATCGAAAGGGCCTTCTGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
551982233 Original CRISPR GGCATATCGAAAGGGCCTTC TGG Intronic