ID: 1000044735_1000044745

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1000044735 1000044745
Species Human (GRCh38) Human (GRCh38)
Location 5:157512887-157512909 5:157512923-157512945
Sequence CCTGACCTACCTCAATTCCCTCC CCCTGGGCTTTGTATCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 239} {0: 1, 1: 0, 2: 2, 3: 15, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!