ID: 1000044737_1000044745

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1000044737 1000044745
Species Human (GRCh38) Human (GRCh38)
Location 5:157512896-157512918 5:157512923-157512945
Sequence CCTCAATTCCCTCCTAAGTCAGA CCCTGGGCTTTGTATCTGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 15, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!