ID: 1000103591_1000103602

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1000103591 1000103602
Species Human (GRCh38) Human (GRCh38)
Location 5:158037931-158037953 5:158037980-158038002
Sequence CCGAGATGGCCGCAGTACAGTCC CATCAGAGGGAGACCGGGGAGGG
Strand - +
Off-target summary {0: 3, 1: 944, 2: 437, 3: 128, 4: 863} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!