ID: 1000220177_1000220185

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1000220177 1000220185
Species Human (GRCh38) Human (GRCh38)
Location 5:159208172-159208194 5:159208221-159208243
Sequence CCCAACCCAGCTCGCGGCAAGCA AACCGGGCCGCCGCCGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 96} {0: 1, 1: 0, 2: 4, 3: 22, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!