ID: 1000220180_1000220183 |
View in Genome Browser |
Spacer: 5 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1000220180 | 1000220183 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 5:159208177-159208199 | 5:159208205-159208227 |
Sequence | CCCAGCTCGCGGCAAGCAGGCAG | CAGCAGTAGCAGCAGCAACCGGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 4, 2: 33, 3: 181, 4: 747} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |