ID: 1000289914_1000289920

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1000289914 1000289920
Species Human (GRCh38) Human (GRCh38)
Location 5:159860682-159860704 5:159860713-159860735
Sequence CCTGATCTAAGGACCAAAGCCCT CTTCCACTATCTACAGACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 103} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!