ID: 1000621250_1000621260 |
View in Genome Browser |
Spacer: 14 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1000621250 | 1000621260 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:163489250-163489272 | 5:163489287-163489309 |
| Sequence | CCTCCTGCTCTGCAGCCGGGTTC | ATGGGTATTGGTCTGTAGCCCGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 31, 2: 293, 3: 761, 4: 1407} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||