ID: 1000621250_1000621260

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1000621250 1000621260
Species Human (GRCh38) Human (GRCh38)
Location 5:163489250-163489272 5:163489287-163489309
Sequence CCTCCTGCTCTGCAGCCGGGTTC ATGGGTATTGGTCTGTAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 31, 2: 293, 3: 761, 4: 1407} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!