ID: 1000644479_1000644481

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1000644479 1000644481
Species Human (GRCh38) Human (GRCh38)
Location 5:163744344-163744366 5:163744361-163744383
Sequence CCAGTCTATTGATGCCATCTTTT TCTTTTTTTTTTTGTCCTTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!