ID: 1000977781_1000977785

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1000977781 1000977785
Species Human (GRCh38) Human (GRCh38)
Location 5:167783727-167783749 5:167783757-167783779
Sequence CCAGTATCTGAAGGGTTCTTTGC CAAATCGCTTGGTCCTGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163} {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!